Skip to main content

Grevo Gerung

Sam Ratulangi University, Fisheries and Marine Science, Faculty Member

Followers

47

Following

22

Co-authors

11

Public Views

1989, Bachelor, Sam Ratulangi University, Faculty of Fisheries and Marine Science, Manado, Indonesia
1994, Master of Science, University of The Ryukyus, Faculty of Science, Okinawa, Japan
2001, Doctor, Hokaido University, Faculty of Fisheries Science, Hokaido, Japan.
Supervisors: Prof. Shintoku Kamura , Prof. Hirotoshi Yamamoto, and Prof. Masao Ohno

less

Interests

Uploads

Papers by Grevo Gerung

VARIASI MORFOMETRIK PADA BEBERAPA LAMUN DI PERAIRAN SEMENANJUNG MINAHASA (Morphometric Variation of the Different Seagrass in Minahasa Peninsula Waters)

Lamun (seagrass) atau disebut juga ilalang laut. Istilah lamun untuk seagrass, pertama-tama diper... more Lamun (seagrass) atau disebut juga ilalang laut. Istilah lamun untuk seagrass, pertama-tama diperkenalkan oleh Hutomo dimana merupakan satu-satunya kelompok tumbuhan hidup di perairan laut dangkal. Lamun tumbuh padat membentuk padang, sehingga dikenal sebagai padang lamun (seagrass beds). Penelitian pada ekosistem padang lamun dimana banyak terjadi kegiatan atau aktivitas pemanfaatan oleh manusia sangatlah terbatas. Oleh karena itu, penelitian ini perlu diadakan sehingga dapat dijadikan sebagai informasi awal bagi peneliti di perairan semenanjung Minahasa. Pengumpulan data dilaksanakan di Perairan Semenanjung Minahasa Sulawesi Utara, khususnya di desa Arakan dan desa Tongkeina. Pengambilan sampel dilakukan dengan menggunakan metode jelajah. Sampel yang telah diperoleh (30 individu per species), diidentifikasi, diukur dengan aplikasi image-J gambar dan diolah menggunakan aplikasi SPSS versi 20.Rata-rata ukuran empat spesies yang diidentifikasi, memiliki variasi dan perbedaan antara s...

UJI AKTIVITAS ANTIOKSIDAN PADA ASTEROIDEA (Linckia laevigata) DARI PERAIRAN TONGKAINA KECAMATAN BUNAKEN KOTA MANADO

JURNAL PESISIR DAN LAUT TROPIS

Indonesia has abundant biological resources that produce many potential bioactive compounds that ... more Indonesia has abundant biological resources that produce many potential bioactive compounds that are useful for pharmaceuticals and other materials, one of which is antioxidants. Antioxidants are substances that can prevent or slow down cell damage caused by free radicals. This study aims to analyze how strong the antioxidant activity is in the body of asteroidea (Linckia laevigata) taken in Tongkaina waters, Bunaken District, Manado City. And this study found that the inhibition value of the ethanolic extract of Linckia laevigata had strong antioxidant activity where the extract increased and the concentration was 10 mg/L with an average value of 67,3 %, a concentration of 15 mg/L of 67,8 %, a concentration of 20 mg/L of 68,8 % and the highest concentration of 25 mg/L getting an average value of 69 %. The increace in the percentage of inhibition and the ethanolic extract of Linckia laevigata, showed that the concentration of the extract contributed greatly to the ability of the ex...

Open Access Corrigendum

This is an Open Access article distributed under the terms of the

Identifikasi Jenis Alga Koralin DI Pulau Salawati, Waigeo Barat Kepulauan Raja Ampat Dan Pantai Malalayang Kota Manado

Coraline alga is one of seaweeds group that classified into Rhodophyta Division, Florideocphyceae... more Coraline alga is one of seaweeds group that classified into Rhodophyta Division, Florideocphyceae class, ordo Cryptonemiales and family Corralinaceae. Based on its morphology (external appearance) Coralinaceae family was divided into articulated/geniculated corraline algae and non-articulated/non-geniculated corraline algae. The objectives of this study are to identify and describe the morphology of these algae. Sampling was done in Raja Ampat Archipelago Regency (Salawati Island and West Waigeo) and Malalayang Coast, Manado. Explore survey method was applied for sampling and samples was taken using SCUBA equipment in 1-5m depth. Collected samples was put into plastic bags then transferred to Marine Biology laboratory FPIK Unsrat. Samples were indentified and documented. This study found four (4) species coraline algae Mastophora rosea from West Waigeo, Amphiroa rigida and Galaxaura rugosa from Salawati Island and Peyssonnelia caulifera from Malalayang Beach.

UJI AKTIVITAS ANTIOKSIDAN DARI EKSTRAK TOTAL ALGA HIJAU Halimeda opuntia Linnaeus DAN Halimeda macroloba Decaisne DARI PERAIRAN TELUK TOTOK (Antioxidant Activity Test of Total Extract of Halimeda opuntia Linnaeus and Halimeda macroloba Decaisne from Totok Bay Waters)

The study was conducted to analyze the antioxidant activity of Halimeda opuntia Linnaeus and Hali... more The study was conducted to analyze the antioxidant activity of Halimeda opuntia Linnaeus and Halimeda macroloba Decaisne. The samples were collected from Totok Bay waters, Ratatotok, Southeast Minahasa Regency and continued with laboratory analysis. The antioxidant activity test applied a spectrophotometer and 1,1-phenyl-2-picryhydrazyl (DPPH). The results showed that total pigmen extract of Halimeda opuntia and Halimeda macroloba that lived in relatively polluted areas could still grow and contained antioxidants. The inhibition rate of both extracts was also generally very high. The smaller the absorbance value is, the higher the inhibition value and the antioxidant activity will be. Penelitian ini dilakukan dengan tujuan untuk menganalisis aktivitas antioksidan dari Halimeda opuntia Linnaeus dan Halimeda macroloba Decaisne. Sampel diperoleh dari perairan Teluk Totok, Ratatotok, Kabupaten Minahasa Tenggara dan dilanjutkan dengan analisis laboratorium. Analisis uji aktivitas antioks...

Struktur morfologi jenis makro alga di perairan Siko Kepulauan Gura Ici Kabupaten Halmahera Selatan Provinsi Maluku Utara

Jurnal Ilmu Kelautan Kepulauan

Penelitian ini dilaksanakan di perairan Siko Kepulauan Gura Ici Kabupaten Halmahera Selatan, Prov... more Penelitian ini dilaksanakan di perairan Siko Kepulauan Gura Ici Kabupaten Halmahera Selatan, Provinsi Maluku Utara pada bulan Pebruari 2005. Tujuan penelitian ini untuk melihat struktur morfologi dan komposisi jenis makro alga. Pengambilan sampel makro alga dilakukan dengan menggunakan metode garis transek (line Transect) di satu stasiun yang telah ditentukan. Pengambilan sampel jenis makro alga dilakukan secara acak pada transek yang telah di plot seluas 100 x 100 meter. Analisis data menggunakan analisis deskriptif. Hasil penelitian teridentifikasi sebanyak 19 jenis yang dibagi dalam tiga divisi, yaitu chlorophyta sebanyak 9 jenis, rhodophyta sebanyak 7 jenis dan phaeophyta sebanyak 3 jenis. Pengukuran morfologi dari jenis makro alga terlihat bahwa diameter batang (thallus) tergolong cukup besar dari ukuran normalnya. Kata kunci: Makro alga, Morfologi, Gura Ici.

berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya. Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL (ribulose-1,5- bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilaria sp. dar

The quality of DNA extraction and gene amplification in algae are influenced by several factors i... more The quality of DNA extraction and gene amplification in algae are influenced by several factors including the characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae may fail for another type of algae. The present study was aimed to examine several DNA extraction techniques and rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene amplifications of Gracilaria sp. collected in Bahoi, North Minahasa (12643’48’’N 1251’33”E). DNA genom of Gracilaria sp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcL gene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 50C). Genomic DNA of Gracilaria sp. was suc...

Potential carbon stocks of seagrass species in Bunaken Island, North Sulawesi, Indonesia

AES Bioflux, 2019

Seagrass meadows are highly valuable ecosystems and play crucial roles in marine ecosystem dynami... more Seagrass meadows are highly valuable ecosystems and play crucial roles in marine ecosystem dynamics by providing food and shelters for many organisms, especially as nursery grounds for commercially important reef fishes. However, seagrass beds around the world have been heavily impacted by human activities. Although marine protected areas have been established globally, seagrass beds remain poorly represented compared to coral reefs. In this study, the researchers gathered preliminary but important baseline information on the Carbon stock (g C m) of different seagrass species around Bunaken Island, North Sulawesi. A total of five species were quantified with the Eelgrass Enhalus acoroides having the highest Carbon stock (47±4.8 g C m) while the rest of the species have Carbon stocks below 10 g C m.

Carbon stock assessment of mangrove ecosystem in Totok Bay, southeast Minahasa Regency, North Sulawesi, Indonesia

This study aims to analyze the blue carbon potential of mangrove ecosystem in Totok Bay waters, S... more This study aims to analyze the blue carbon potential of mangrove ecosystem in Totok Bay waters, Southeast Minahasa Regency, North Sulawesi, using line transect method with 10 x 10 m quadrat placed seaward perpendicular to the shore. Preliminary survey observation found 3 species of mangrove, Rhizophora mucronata, Avicennia alba and Bruguiera gymnorhiza. Vegetation analysis was to determine the role of mangrove species using Important Value Index (IVI). IVI obtained was 147.47% for R. mucronata, 60.99% for A. alba, and 91.53% for B. gymnorhiza, respectively. Biomass measurements provided information on carbon stock. Data obtained was analyzed using allometric equation. Results showed that mean carbon stock of the mangrove biomass in Totok Bay was 17.1 kg MgC ha. Physical and chemical parameters analyses were also conducted as supporting data of carbon stock. Mean total carbon sink in mangrove sediment was 286.18 Mg ha. Mean blue carbon potential absorption was 193. 28 ton C ha. This ...

Daya Tarik Investasi Kabupaten/Kota di Indonesia, 2004: Peringkat 214 Kabupaten/Kota di Indonesia & Gambaran Permasalahan Dunia Usaha

KPPOD (Komite Pemantauan Pelaksanaan Otonomi Daerah) yang hadir sepanjang usia otda tersebut, ber... more KPPOD (Komite Pemantauan Pelaksanaan Otonomi Daerah) yang hadir sepanjang usia otda tersebut, berusaha mewujudkan visinya untuk ikut serta menciptakan iklim usaha yang kondusif di era otonomi ini melalui berbagai kegiatan yang dilakukannya. Dalam salah satu kegiatan tahunannya, KPPOD mengadakan penelitian mengenai “Pemeringkatan Daya Tarik Investasi Kabupaten/Kota Tahun 2004” yang meliputi 161 Kabupaten dan 53 Kota di Indonesia. Kegiatan tersebut merupakan pemeringkatan keempat, setelah sebelumnya melaksanakannya di 90 Kabupaten/Kota di tahun 2001, 134 Kabupaten/ Kota di tahun 2002, san 200 Kabupaten/Kota di tahun 2003. Selain untuk referensi para pelaku usaha dalam mempertimbangkan keputusan investasinya, kegiatan tersebut juga dimaksudkan untuk mendorong kompetisi yang sehat antar daerahdaerah otonom dalam memfasilitasi aktivitas perekonomian. Antusiasme kalangan dunia usaha untuk mempelajari hasil penelitian tersebut di tahun tahun sebelumnya dan beragam tanggapan dari daerah-dae...

Macroalgae Biodiversity in Ondong Coastal Waters

Jurnal Ilmiah PLATAX

This research was conducted in the coastal waters of Ondong, West Siau District, Siau Islands Reg... more This research was conducted in the coastal waters of Ondong, West Siau District, Siau Islands Regency Tagulandang Biaro with the aim of knowing the composition of macroalgae taxa through a morphological approach. Data retrieval is done by using the Line Transect quadratic method. The results of the study found 15 species consisting of 3 divisions, 3 classes, 10 orders, 12 families, and 12 genera.AbstrakPenelitian ini dilakukan di perairan pesisir pantai Ondong, Kecamatan Siau Barat, Kabupaten Kepulauan Siau Tagulandang Biaro dengan tujuan untuk mengetahui komposisi taksa makroalga melalui pendekatan morfologi. Pengambilan data dilakukan dengan menggunakan metode Line Transect kuadrat. Hasil penelitian menemukan 15 spesies yang terdiri dari 3 divisi, 3 kelas, 10 ordo, 12 famili, dan 12 genera.

Bottom Gill Net Modification for Fish Catch Development and Coral Damage Prevention

One of the problems encountered in coastal areas and small islands in Indonesia is habitat degrad... more One of the problems encountered in coastal areas and small islands in Indonesia is habitat degradation, especially the coral reef. Bottom gillnets have been commonly used by traditional fishermen, but it is not environmentally friendly. When lifting the net, coral rubbles are also taken up because the sinker line and sinker are in direct contact with the sea bottom. The use of bridle line on the sinker line can minimize damages of the bottom habitat. This research aimed at comparing the effect of using bottom gillnet with bridle line and strapping bands on fish catch and coral damages. The bridle line used was 100 cm long, while the strapping band distance intervals were different. This study revealed that addition of strapping bands between the bridle line could improve fish catch compared with the use of anly bridle line. Also, it did not affect the coral lifted.

format_quoteModification of gillnet with bridle line and strapping bands enhances fish catch while reducing coral damage, optimizing fishing operations.format_quote

A new clade of Thalassia hemprichii (Ehrenberg) Ascherson from the waters of North Sulawesi and West Papua, Indonesia revealed using chloroplast (rbcL) DNA

This study describes the genetic characteristics of Thalassia hemprichii in waters of North Sulaw... more This study describes the genetic characteristics of Thalassia hemprichii in waters of North Sulawesi and West Papua, Indonesia using specific rbcL spacer primers. Samples of T. hemprichii were taken from Arakan (South Minahasa Regency), Tongkaina and Tanjung Merah (both in North Minahasa Regency), and Waisai (Raja Ampat Regency) in West Papua. The chloroplast DNA extraction was done using innuPrep DNA Micro Kit, edited with Geneious V6.0 software and compared with existing sequences in GenBank to infer molecular phylogenetic relationships between samples of this species and closelyrelated taxa. Neighbour-joining phylogenetic trees revealed two distinct clades: clade 1 (Tanjung Merah, Tongkaina, and Waisai), and clade 2 (Arakan), the latter tend to support an earlier study which showed distinct morphological structures such as longer nodes and underground structures (e.g. rhizome). Future studies should investigate in details genetic connectivity of T. hemprichii, especially in relat...

Study on Indonesian Gracilariaceae(Rhodophyta,Gigartinales)

Regional Investment Attractiveness in Indonesia, 2004: Rating to 214 Regencies/Cities in Indonesia & Problems on Business Environment

KPPOD (Komite Pemantauan Pelaksanaan Otonomi Daerah/Regional Autonomy Watch), which is existing a... more KPPOD (Komite Pemantauan Pelaksanaan Otonomi Daerah/Regional Autonomy Watch), which is existing all along with the age of otda, is seeking to realize its vision of partaking in the creation of conducive business climate in the era of autonomy through various activities. As one of its annual activity, KPPOD conducted a “Rating on Investment Attractiveness of Regencies/Cities for Year 2004” covering 161 Regencies and 53 Cities in Indonesia. The study is the fourth rating; the first was in 2001 covering 90 Regencies/Cities, the second was in 2002 with 134 Regencies/Cities, while the third was in 2003 with 200 Regencies/Cities. Apart from being a reference for business players in weighing investment decision, said activity is intended to induce healthy competition among autonomous regions in facilitating economic activities. Likewise, the activity is expected to become one of the means to assist principal parties to evaluate the otda, the program that is on-going and will continue to go...

Anatomical characteristics of macroalgal species from Bombuyanoi Island, East Bolaang Mongondow Regency, North Sulawesi

AQUATIC SCIENCE & MANAGEMENT

This research aims to study the anatomical structure of macroalgae. Sample of macroalga was colle... more This research aims to study the anatomical structure of macroalgae. Sample of macroalga was collected by using Line Intercept Transect (LIT) method with sampling quadrat. Macroalgae samples were dried and separated from the roots, stems, leaves and receptacles (if present). Samples were cut transversely and longitudinally at each section and observed under binoculared microscope of Olympus CX with monitor. Based on the histology, anatomical structure of macroalgae species can be divided into two tissues from outside to inside, namely cortex and medullary cells. The cortex is composed of one layer or more. The cortex is the area between the epidermis and the central column. The medulla cells only have one layer which is the largest layer. Based on the observation result of cells type from observed spesies Eucheuma denticilatum, Gracilaria arcuata, Hydropuntia edulis, G. salicornia, Hypnea valentiae, Turbinaria deccurens, and T. ornata, it shows that cells of medulla become small towa...

DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency

AQUATIC SCIENCE & MANAGEMENT

Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carbox... more Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae. The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGA...

Community structure of seaweed beds in Mantehage Island, North Sulawesi, Indonesia

AQUATIC SCIENCE & MANAGEMENT

Title (Bahasa Indonesia): Struktur komunitas rumput laut di Pulau Mantehage, Provinsi Sulawesi Ut... more Title (Bahasa Indonesia): Struktur komunitas rumput laut di Pulau Mantehage, Provinsi Sulawesi Utara Seaweeds are an important marine resource for coastal community. They are used as medicine, paper materials, biofuel and direct consumption as vegetable or in food industries. Data collection in Mantehage island used Seagrass Watch method combined with line transect method with quadrat. This study found 29 species of seaweeds consisting of 13 species of Chlorophyta, 4 species of Phaeophtya and 12 species of Rhodophyta. Water temperatures ranged from 28–30ºC and pH ranged from 8.14–8.69, while salinity ranged between 30.8–31.9 ppt. Mantehage island waters has 100 % visibility with the current speed range of 30–42 cm/sec. INP of Caulerpa racemosa has the highest value at all sites. Diversity index ranged from 0.799–1.093 considered as low and dominance index ranged between 0.635–0.697 categorized as normal. Eveness index ranged from 0.303–0.365 showing that the seaweed community was un...

Analysis of growth and quality of seaweed carrageenan Kappaphycus alvarezii in different locations on the Banggai’s Waters, Central Sulawesi

AQUATIC SCIENCE & MANAGEMENT

Title (Bahasa Indonesia): Analisis pertumbuhan dan kualitas karagenan rumput laut Kappaphycus alv... more Title (Bahasa Indonesia): Analisis pertumbuhan dan kualitas karagenan rumput laut Kappaphycus alvarezii pada lokasi berbeda di Wilayah Perairan Banggai ProvinsiSulawesi Tengah Seaweed is a potential of coastal resources. Carrageenan is a polysaccharide extracted from seaweed or some species of red algae (Rhodophyceae). Seaweed growth is strongly influenced by two factors: internal and external factors. But twthat determine the success of the seaweed growth is the management carried out by people working on it. Banggai Regency is one of the largest seaweed production centers in Central Sulawesi. The main objective of this studyis toexamine the potential of seaweed cultivation (Kappaphycus avarezii) by looking at the growth and the carrageenan, inBanggai waters, Central SulawesiProvince. The temperature range obtained during this study r25to 31ºC. The results of carrageenananaliysis wasvery different due to differences inlocation, showed by content. The highest and lowest ashcontentw...

A study on bioecology of macroalgae, genus Caulerpa in northern Minahasa Waters, North Sulawesi Province

AQUATIC SCIENCE & MANAGEMENT

Alga is a marine resource of potential to fisheries and marine sector. It has an important econom... more Alga is a marine resource of potential to fisheries and marine sector. It has an important economic value to promote the economy in Indonesia. Nowdays, algae have been used as a relatively high value fisheries commodity since it has been used for food, industrial, pharmaceutical and cosmetic raw materials. This important potential needs to be supported with understanding of its biology and ecology, so that its utilization could increase the livelihood of the coastal villagers. This study was aimed at inventorying and identifying the members of genus Caulerpa found in North Minahasa Regency waters and studying some biological and ecological aspects of the algae in the area. Resuls showed that there were 7 species recorded, Caulerpa racemosa, C. racemosa var. macrophysa, C. sertularioides, C. taxifolia, C. serrulata,C. lentillifera and C. peltata. Ecologically, the environmental parameters, such as water temperature, salinity, pH, dissolved oxygen, turbidity, were in tolerable ranges ...